View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18338_high_5 (Length: 339)
Name: NF18338_high_5
Description: NF18338
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18338_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 74; Significance: 6e-34; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 235 - 336
Target Start/End: Original strand, 4222870 - 4222971
Alignment:
| Q |
235 |
tgtggttagaatctctggtgcattgtagccaagacttccttttatagcaatgacgtttttgtttgctgaagttgacattaaaagaccaaatctgggatgt |
334 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||| ||||| |||| |||||||| ||||| |
|
|
| T |
4222870 |
tgtggttaaaatctctggtgcattgtagccaagagttccttttatagcaatgacgtttttgttggctgaagttgtcattataagaacaaatctgcgatgt |
4222969 |
T |
 |
| Q |
335 |
ga |
336 |
Q |
| |
|
|| |
|
|
| T |
4222970 |
ga |
4222971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 151 - 209
Target Start/End: Original strand, 3824035 - 3824093
Alignment:
| Q |
151 |
tttcttagaccatcctttgtgtcatttcttaatgcacacattctgtatatttcttttgt |
209 |
Q |
| |
|
||||||| ||| || ||||| ||||||||||||||||| ||| |||||||| ||||||| |
|
|
| T |
3824035 |
tttcttaaaccgtcttttgtttcatttcttaatgcacaaattttgtatattccttttgt |
3824093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University