View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18338_low_13 (Length: 249)
Name: NF18338_low_13
Description: NF18338
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18338_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 7273285 - 7273517
Alignment:
| Q |
1 |
ttagattttgcaagttaaggttaaattttaattaatttggtcttataagatagtacaatgcaataaccaaactagctacaagactaaaaggagcaactca |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7273285 |
ttagattttgcaagttaaggttatattttaattaatttggtcttataagatagtacaatgcaataaccaaactagctacaagactaaaaggagcaactca |
7273384 |
T |
 |
| Q |
101 |
ataagctaggttaggtgggttttggacggtttaagc-aagcaatatgaagggtcatttgaattttgaactttctaacaaaaattaggtgtaatgcacttt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| ||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7273385 |
ataagctaggttaggtgggttttggacggtttaagcaaagcaataagaagggtca-------tttgaactttctaacaaaaattaggtgtaatgcacttt |
7273477 |
T |
 |
| Q |
200 |
tggtgcctattttctctaatttctaatttattgtcttcat |
239 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7273478 |
ttgtgcctattttctctaatttctaatttattgtcttcat |
7273517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University