View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18338_low_17 (Length: 217)
Name: NF18338_low_17
Description: NF18338
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18338_low_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 19 - 207
Target Start/End: Complemental strand, 42089024 - 42088836
Alignment:
| Q |
19 |
catcgtgttaccaagcaggacctcatttccctgagaaccagagggtttagacaaaataaatcgagaattcaatcaatggtgtaacgggtttggaccagta |
118 |
Q |
| |
|
||||||||||||||||| |||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42089024 |
catcgtgttaccaagcatgacctcattttcctgagaaccagagggttaagacaaaataaatcgagaattcaatcaatggtgtaacgggtttggaccagta |
42088925 |
T |
 |
| Q |
119 |
ggcacacggcgcttctcaaccccataacgtgggtcgatcgctgtgtctgaaggatccttctgcactgcaaaaccttgaggatgatgatg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42088924 |
ggcacacggcgcttctcaaccccataacgtggatcgatcgctgtgtctgaaggatccttctgcactgcaaaaccttgaggatgaagatg |
42088836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University