View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18338_low_5 (Length: 387)
Name: NF18338_low_5
Description: NF18338
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18338_low_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 67; Significance: 1e-29; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 309 - 375
Target Start/End: Original strand, 10876552 - 10876618
Alignment:
| Q |
309 |
caactttgttttatgaatgcacaatacagttggacatttgtccttaactaacctcaacacctccctt |
375 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10876552 |
caactttgttttatgaatgcacaatacagttggacatttgtccttaactaacctcaacacctccctt |
10876618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 16 - 46
Target Start/End: Original strand, 10876485 - 10876515
Alignment:
| Q |
16 |
ataacaaactcaactcttctgacaataaaaa |
46 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
10876485 |
ataacaaactcaactcttctgacaataaaaa |
10876515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University