View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18338_low_8 (Length: 300)

Name: NF18338_low_8
Description: NF18338
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18338_low_8
NF18338_low_8
[»] chr5 (1 HSPs)
chr5 (13-284)||(4570019-4570281)


Alignment Details
Target: chr5 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 13 - 284
Target Start/End: Complemental strand, 4570281 - 4570019
Alignment:
13 gggtacctgacgacattttggacaaaattgctagtatattaccatctgaagatgaggaaggagctgattcttgcaatattatagtagcaaatgcgggaca 112  Q
    |||||||||| |||||||||||||||||||||| |||||| ||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
4570281 gggtacctgaagacattttggacaaaattgctattatattgccacctgaagatgaggaaggagctgattcttgcaatattatagtagcagatgcgggaca 4570182  T
113 attttcaattgctgctatgatagaactaattggaaggaaatttggaatttaaaggtaccggaaagggtgcgccatttcatttggattttgcactgcgata 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||      
4570181 attttcaattgctgctatgatagaactaattggaaggaaatttggaatttaaaggtaccggaaagggtgcgccatctcatttggattttgcactacga-- 4570084  T
213 ggttactcaccaattacaataaaagtagaatgggtttgggaagttcaatgtgtggttattgttgtaaattgt 284  Q
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4570083 -------caccaattacaataaaagtagaatgggtttgggaagttcaatgtgtggttattgttgtaaattgt 4570019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University