View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18338_low_8 (Length: 300)
Name: NF18338_low_8
Description: NF18338
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18338_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 13 - 284
Target Start/End: Complemental strand, 4570281 - 4570019
Alignment:
| Q |
13 |
gggtacctgacgacattttggacaaaattgctagtatattaccatctgaagatgaggaaggagctgattcttgcaatattatagtagcaaatgcgggaca |
112 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |||||| ||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
4570281 |
gggtacctgaagacattttggacaaaattgctattatattgccacctgaagatgaggaaggagctgattcttgcaatattatagtagcagatgcgggaca |
4570182 |
T |
|
| Q |
113 |
attttcaattgctgctatgatagaactaattggaaggaaatttggaatttaaaggtaccggaaagggtgcgccatttcatttggattttgcactgcgata |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||| |
|
|
| T |
4570181 |
attttcaattgctgctatgatagaactaattggaaggaaatttggaatttaaaggtaccggaaagggtgcgccatctcatttggattttgcactacga-- |
4570084 |
T |
|
| Q |
213 |
ggttactcaccaattacaataaaagtagaatgggtttgggaagttcaatgtgtggttattgttgtaaattgt |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4570083 |
-------caccaattacaataaaagtagaatgggtttgggaagttcaatgtgtggttattgttgtaaattgt |
4570019 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University