View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18339_high_11 (Length: 562)
Name: NF18339_high_11
Description: NF18339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18339_high_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 9e-93; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 9e-93
Query Start/End: Original strand, 318 - 548
Target Start/End: Complemental strand, 30343750 - 30343503
Alignment:
| Q |
318 |
accataatatccaactcaaccaatcaattttcca------cttttgtaatatcaaaaatcactagcagccagccagtaactgaacagaacagtcacaaca |
411 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30343750 |
accataatatccaactcaaccaaacaattttccaaggctacttttgtaatatcaaaaatcactagcagccagccagtaactgaacagaacagtcacaaca |
30343651 |
T |
|
| Q |
412 |
aactctgtcccatcccatcccaatgactcaacatattaataccataccacacacaatcctcaataaacacaaaaccacattctcttattccacttttcta |
511 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30343650 |
aactctgtcccatcccatcccaatgactcaacatattaataccatacc-cacacaatcctcaataaacacaaaaccacattctcttattccacttttcta |
30343552 |
T |
|
| Q |
512 |
ctc------------ccaaacattcatattcattccaatggctctattt |
548 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
30343551 |
ctctcaaaaaaccaaccaaacattcatattcattccaatggctctattt |
30343503 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 152; E-Value: 3e-80
Query Start/End: Original strand, 9 - 187
Target Start/End: Complemental strand, 30344048 - 30343874
Alignment:
| Q |
9 |
agtgagatgaaatgagtcacgtgatgtgcactgcatagtttagtttagtttaggtgaagagggcgttacatgtcgctctcttagcc-agccagtttcgac |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
30344048 |
agtgagatgaaatgagtcacgtgatgtgcactgcatagtttagtttag-----gtgaagagggcgttacatgtcgctctcttagcccagccagtttcgac |
30343954 |
T |
|
| Q |
108 |
actgctgtaagtcggctaatgcggcgcacctctgtctgtctcttccttcctttgcattgcagcaggtttctgtctcacaa |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30343953 |
actgctgtaagtcggctaatgcggcgcacctctgtctgtctcttccttcctttgcattgcagcaggtttctgtctcacaa |
30343874 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University