View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18339_high_24 (Length: 410)
Name: NF18339_high_24
Description: NF18339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18339_high_24 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 42 - 396
Target Start/End: Original strand, 6049376 - 6049728
Alignment:
| Q |
42 |
agcctatcattatcctcgcctcaataccatgtatttgggtttgctaggagggagggagggagagagagattcaccaatgcatggcatgcaaatcaatatt |
141 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
6049376 |
agcctatcattatcctcgcctccataccatgtatttgggtttgctaggagggagggag--agagagagatttaccaatgcatggcatgcaaatcaatatt |
6049473 |
T |
|
| Q |
142 |
atagacatcgacatgactgtgctgtacattttttctctctgggctataagcaatgcagcaacaaattgtattattaaaatttgctgcaaagccaaatagc |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6049474 |
atagacatcgacatgactgtgctgtacattttttctctctaggctataagcaatggagcaacaaattgtattattaaaatttgctgcaaagccaaatagc |
6049573 |
T |
|
| Q |
242 |
tagctgatgagaacagaacagctgcggcaaaccctaaattatatattatattgtggagaaatcatgatcactcagaaaattcgaaatctgtacggttact |
341 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
6049574 |
tagctgatgagaacagaacagctgcggcaaaccctaaattatatattatattgtggagaaatcataatcactcataaaattcgaaatctgtacggttact |
6049673 |
T |
|
| Q |
342 |
tgttactacatattttatttagtttgcagtactgtcttctcattgctatatatat |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6049674 |
ggttactacatattttatttagtttgcagtactgtcttctcattgctatatatat |
6049728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 39279295 - 39279255
Alignment:
| Q |
1 |
ttttccatatctcttattgtggactataacatactttgttt |
41 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
39279295 |
ttttccatatctcttattgtggaatataacatactttgttt |
39279255 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University