View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18339_high_26 (Length: 394)
Name: NF18339_high_26
Description: NF18339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18339_high_26 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 352; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 352; E-Value: 0
Query Start/End: Original strand, 1 - 376
Target Start/End: Complemental strand, 9791623 - 9791248
Alignment:
| Q |
1 |
attttgatgaagggactttgtttaacgaataggattggtgaaggttttaagcttttgcagcttattaagaataacggggttacacccaatactgttattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
9791623 |
attttgatgaagggactttgtttaacgaataggattggtgaaggttttaagcttttgcagcttattaagaataacggggttacaccaaatactgttattt |
9791524 |
T |
|
| Q |
101 |
ataatactttgcttcatgcactttgtaggaatggaaaaattggtagggctaggagcttgatgaatgagatggtggacccgaatgaggttacgtttaatat |
200 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9791523 |
acaatactttgcttcatgcactttgtaggaatggaaaagttggtagggctaggagcttgatgaatgagatggtggacccgaatgaggttacgtttaatat |
9791424 |
T |
|
| Q |
201 |
tttgatatcttcttattgtaaggaagagaatttagtccaagctcttgttttgcttgagaagtgttttgcattgagtcttgtacctgatgttgttaccgtg |
300 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
9791423 |
tttgatatcttcttattataaggaagagaatttagtccaagctcttgttttgcttgagaagtgctttgcattgagtcttgtacctgatgttgttaccgtg |
9791324 |
T |
|
| Q |
301 |
actaaggtggttgagattctatgcaatgctggccgtgtaacggaggctaccgaggtgcttgagagagttgagagct |
376 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
9791323 |
actaaggtggttgagattctatgcaatgctggccgtgtaacggaggctgccgaggtgcttgagagagttgagagct |
9791248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University