View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18339_high_47 (Length: 276)
Name: NF18339_high_47
Description: NF18339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18339_high_47 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 20 - 265
Target Start/End: Original strand, 32668802 - 32669050
Alignment:
| Q |
20 |
aatcgttctaataaaatcagtcttctgtgtgcttcttgtttactatcttttctttttcaaggctccgg---gtataatctcaaaacttgaatatcttttc |
116 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
32668802 |
aatcgttctaataaaattagtcttgcatgtgcttcttgtttactatcttttctttttcaaggctccggcaggtataatctcaaaacttgaatatcttttc |
32668901 |
T |
 |
| Q |
117 |
aaacaatttttatggggaggaagtgagcatgtgagaaaaataaactgggttaaatgggaaagaccttatagcatagcatcaatcaatggtgcataaatcc |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32668902 |
aaacaatttttatggggaggaagtgagcatgtgagaaaaataaactgggttaaataggaaagaccttatagcatagcatcaatcaatggtgcataaatcc |
32669001 |
T |
 |
| Q |
217 |
gagggtatgtattggagttttatggtaacttgatcactcgaagcttcat |
265 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
32669002 |
gagggtatgtatgggagttttatggtgacttgatcacttgaagcttcat |
32669050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 79; Significance: 5e-37; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 25 - 177
Target Start/End: Complemental strand, 23703152 - 23702996
Alignment:
| Q |
25 |
ttctaataaaatcagtcttctgtgtgcttcttgtttactatcttttctttttcaaggctccgg---gtataatctcaaaacttgaatatcttttcaaaca |
121 |
Q |
| |
|
||||||||||||||||||| | || ||||| |||||||| ||||| ||||||||||||| || |||||||||| |||||||||| |||||||||||| |
|
|
| T |
23703152 |
ttctaataaaatcagtcttgtctgcgcttcctgtttactttctttcctttttcaaggcttcgacgagtataatctcgaaacttgaatctcttttcaaaca |
23703053 |
T |
 |
| Q |
122 |
attttt-atggggaggaagtgagcatgtgagaaaaataaactgggttaaatgggaaa |
177 |
Q |
| |
|
||||| |||||||||||||||| |||||||||||| ||| |||||||||||||||| |
|
|
| T |
23703052 |
tttttttatggggaggaagtgaggatgtgagaaaaagaaattgggttaaatgggaaa |
23702996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 71 - 175
Target Start/End: Complemental strand, 29122023 - 29121916
Alignment:
| Q |
71 |
ctttttcaaggctccgg---gtataatctcaaaacttgaatatcttttcaaacaatttttatggggaggaagtgagcatgtgagaaaaataaactgggtt |
167 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||||||| ||||||||||||||| | |||||||| ||||| || ||||||||||| |||||| |
|
|
| T |
29122023 |
ctttttcaaggctccgacaagtataatctctaaacttgaatctcttttcaaacaattcatgtggggagggtgtgagggggtaagaaaaataaattgggtt |
29121924 |
T |
 |
| Q |
168 |
aaatggga |
175 |
Q |
| |
|
|||||||| |
|
|
| T |
29121923 |
aaatggga |
29121916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 27235299 - 27235355
Alignment:
| Q |
30 |
ataaaatcagtcttctgtgtgcttcttgtttactatcttttctttttcaaggctccg |
86 |
Q |
| |
|
|||||||||||||| | || ||||| |||||||| ||||| ||||||| |||||||| |
|
|
| T |
27235299 |
ataaaatcagtcttgtctgcgcttcctgtttactttctttcctttttcgaggctccg |
27235355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 111 - 175
Target Start/End: Original strand, 39294463 - 39294527
Alignment:
| Q |
111 |
cttttcaaacaatttttatggggaggaagtgagcatgtgagaaaaataaactgggttaaatggga |
175 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| | ||| |||||||||| ||| |||||||||| |
|
|
| T |
39294463 |
cttttcaaacaatttttatggggagggagtgaggaagtgtgaaaaataaattggattaaatggga |
39294527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 99 - 143
Target Start/End: Complemental strand, 22638980 - 22638936
Alignment:
| Q |
99 |
aaacttgaatatcttttcaaacaatttttatggggaggaagtgag |
143 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
22638980 |
aaacttgaatctcttttcaaacaatttttatggggagggagtgag |
22638936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University