View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18339_high_50 (Length: 251)
Name: NF18339_high_50
Description: NF18339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18339_high_50 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 3856392 - 3856168
Alignment:
| Q |
1 |
cgttccattgcagagaccagatgcttgatcaacgttgcgaagcaacatgacaggaactccaaccttcaaacataattattattttttctaannnnnnnnn |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3856392 |
cgttccattgcagagaccagatgcttgatcaacgttgcgaagcaacatgacatgaactccaaccttcaaacataattattattttttctaa-tttttttt |
3856294 |
T |
|
| Q |
101 |
atgtgtgtgactaaatagagtgaccaaatacttgtgtccattcaagaattgctccttttcaaaagcccnnnnnnnnnactttcaaaatcaacgaagaagg |
200 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3856293 |
atgtgt-------------gtgaccaaatacttgtgtccattcaagaattgctccttttcaaaagccc--tttttttactttcaaaatcaacgaagaagg |
3856209 |
T |
|
| Q |
201 |
aggatcagctcatggtttcttaaactatactccgtcctatg |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3856208 |
aggatcagctcatggtttcttaaactatactccgttctatg |
3856168 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 74; Significance: 5e-34; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 2 - 75
Target Start/End: Complemental strand, 46471423 - 46471350
Alignment:
| Q |
2 |
gttccattgcagagaccagatgcttgatcaacgttgcgaagcaacatgacaggaactccaaccttcaaacataa |
75 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46471423 |
gttccattgcagagaccagatgcttgatcaacgttgcgaagcaacatgacaggaactccaaccttcaaacataa |
46471350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 5 - 69
Target Start/End: Complemental strand, 33446197 - 33446133
Alignment:
| Q |
5 |
ccattgcagagaccagatgcttgatcaacgttgcgaagcaacatgacaggaactccaaccttcaa |
69 |
Q |
| |
|
|||||||| ||||||| | |||||||||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
33446197 |
ccattgcacagaccagccgattgatcaacgttgcgaagcaacataacaggaacaccaaccttcaa |
33446133 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 104 - 150
Target Start/End: Original strand, 43377706 - 43377752
Alignment:
| Q |
104 |
tgtgtgactaaatagagtgaccaaatacttgtgtccattcaagaatt |
150 |
Q |
| |
|
||||||||||||||||| | |||||| ||||||||||| |||||||| |
|
|
| T |
43377706 |
tgtgtgactaaatagagggtccaaattcttgtgtccatccaagaatt |
43377752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University