View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18339_high_58 (Length: 221)

Name: NF18339_high_58
Description: NF18339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18339_high_58
NF18339_high_58
[»] chr3 (1 HSPs)
chr3 (17-199)||(51375008-51375190)


Alignment Details
Target: chr3 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 17 - 199
Target Start/End: Original strand, 51375008 - 51375190
Alignment:
17 gtgatgaattgaattatttgaaatactatttgaagaggatgggttgaatgtgagagagaggcatgtgtgcatgcttaaatagagaaagaaagagtggaat 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51375008 gtgatgaattgaattatttgaaatactatttgaagaggatgggttgaatgtgagagagaggcatgtgtgcatgcttaaatagagaaagaaagagtggaat 51375107  T
117 tgggtattgagttgaaatataattaccaggttgcaccttgacttgtttgagaatggtgtttgaatacaaaaggttgaaaggga 199  Q
    |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51375108 tgggtattgagttgaaatataattaccaagttgcaccttgacttgtttgagaatggtgtttgaatacaaaaggttgaaaggga 51375190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University