View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18339_low_34 (Length: 369)
Name: NF18339_low_34
Description: NF18339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18339_low_34 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 339; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 339; E-Value: 0
Query Start/End: Original strand, 16 - 358
Target Start/End: Complemental strand, 18720915 - 18720573
Alignment:
| Q |
16 |
tcatagtgagctatgctcaacacggtaaaggggcagatgctttagctgcatatgaacttatgaaaagtgaaggagttgaacctgatgcagtaacttttgt |
115 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18720915 |
tcatattgagctatgctcaacacggtaaaggggcagatgctttagctgcatatgaacttatgaaaagtgaaggagttgaacctgatgcagtaacttttgt |
18720816 |
T |
|
| Q |
116 |
tgggattctatcggcttgtagccatagtggactggttgaagaagccttcttctatctaaactcaatgattgaagactacaagattacaccgagtcatcgc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18720815 |
tgggattctatcggcttgtagccatagtggactggttgaagaagccttcttctatctaaactcaatgattgaagactacaagattacaccgagtcatcgc |
18720716 |
T |
|
| Q |
216 |
cattatgcttgtattgttgatattcttggtcgatctggtagattaagagaagctgaaagtttcataaacaacatgcctgttgagcctaatgcgctgatct |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18720715 |
cattatgcttgtattgttgatattcttggtcgatctggtagattaagagaagctgaaagtttcataaacaacatgcctgttgagcctaatgcgctgatct |
18720616 |
T |
|
| Q |
316 |
ggggaacactgcttgctgcttgtaaggttcatggtgattttga |
358 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18720615 |
ggggaacactgcttgctgcttgtaaggttcatggtgattttga |
18720573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University