View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18339_low_56 (Length: 245)
Name: NF18339_low_56
Description: NF18339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18339_low_56 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 11 - 227
Target Start/End: Original strand, 43003964 - 43004181
Alignment:
| Q |
11 |
agaatataaaggcgagtcaattagaaacaaaagcgtattcttttannnnnnnnn-ggtcaagtactagagctagtggcgtgtccggtgttcgaattccga |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||| |||||||||| ||||| | |||||||||||||||| ||||||| |
|
|
| T |
43003964 |
agaatataaaggcgagtcaattagaaacaaaagcctattcttttatttttcttttggtcaagtaccagagccactggcgtgtccggtgtttgaattccag |
43004063 |
T |
|
| Q |
110 |
ctgctgtatatagtatacgatattctatcaaccgacttaaactcgcgggagattcaagagtgtttgttatgtgtagcaatttatagtgggagatagaaac |
209 |
Q |
| |
|
|||| | ||||| ||||| ||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43004064 |
ctgccgcatataatataccatattctatcaactgacttaaactcgcgggggattcaagagtgtttgttatgtgtagcaatttatagtgggagatagaaac |
43004163 |
T |
|
| Q |
210 |
aacttttcaacttggttg |
227 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
43004164 |
aacttttcaacttggttg |
43004181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University