View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1833_high_7 (Length: 362)
Name: NF1833_high_7
Description: NF1833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1833_high_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 323; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 323; E-Value: 0
Query Start/End: Original strand, 18 - 352
Target Start/End: Original strand, 35446102 - 35446436
Alignment:
| Q |
18 |
aaaacggaggtgaaagtgtaggaagaaggtttgtgaggggaagaaagcatacgacggtagaaaaagatagtgtcaagggagaaaccgtgctgggaagagg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35446102 |
aaaacggaggtgaaagtgtaggaagaaggtttgtgaggggaagaaagcatacgacggtagaaaaagatagtgtcaagggagaaaccgtgctgggaagagg |
35446201 |
T |
|
| Q |
118 |
ctttgatgagggaattaaagaggaaggaatcggggtcggtgacagagaggaagagacggcgggtgtaggcgatggaaccggcggcggaggagagagtgag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35446202 |
ctttgatgagggaattaaagaggaaggaatcggggtcggtgacagagaggaagagacggcgggtgtaggcgatggaaccggcggcggaggagagagtgag |
35446301 |
T |
|
| Q |
218 |
gagtttggtgagaagggcacgactacggtgacgaccggagacaatgagatgagcatgagcttgttggagaggtcgaatgtgtgggccagcacgtatcact |
317 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35446302 |
gagtttggtgaggagggcacgactacggtgacgacctgagacaatgagatgagcatgagcttgttggagaggtcgaatgtgtgggccagcacgtatcact |
35446401 |
T |
|
| Q |
318 |
gcttcgtattctacagattttgatctttgcctttg |
352 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |
|
|
| T |
35446402 |
gcttcgtattctacagattttgatctttgtctttg |
35446436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University