View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1833_low_11 (Length: 266)
Name: NF1833_low_11
Description: NF1833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1833_low_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 15 - 255
Target Start/End: Original strand, 32742587 - 32742826
Alignment:
| Q |
15 |
aaaaatgaacgacaggagaagttgtttgaatgaaacaaacattcatatggattttaagagctttctttagtggtatacacttctaaattctaattccact |
114 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32742587 |
aaaaataaacgacaggagaagttgtttgaatgaaacaaacattcatatggattttaagagctttctttagtggtatacacttctaaattctaattccact |
32742686 |
T |
 |
| Q |
115 |
ggccactatttattctttttacggttttatttcacctattaaacgattgttaccttcattttggtattataactattttttgtgtttcctcttcaaacat |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
32742687 |
ggccactatttattctttttacggttttatttcacctattaaacgcttgttaccttcattttggtgtcataactattttttgtgtttcctcttcaaacat |
32742786 |
T |
 |
| Q |
215 |
gagagttttctttctcttgttgttcatcactttagtttctt |
255 |
Q |
| |
|
||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
32742787 |
gagaggtttc-ttctcttgttgttcatcactttagtttctt |
32742826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University