View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1833_low_13 (Length: 250)
Name: NF1833_low_13
Description: NF1833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1833_low_13 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 218; Significance: 1e-120; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 3 - 236
Target Start/End: Complemental strand, 23265764 - 23265531
Alignment:
| Q |
3 |
gtgattgttgcagtgactgcgaaccctacttttctatttctggtttctttgttttcttcttggcaaggaaaggtacaaaagaagaatatgaatgaaactt |
102 |
Q |
| |
|
||||||||||| ||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
23265764 |
gtgattgttgccgtgaccgcaaaccctacttttctatttctggtttctttgttttcttcttggcaaggaaagctacaaaagaagaatatgaatgaaactt |
23265665 |
T |
|
| Q |
103 |
gagaatttactactgaaggataagccagtgattaatatcctaattaatttcttcagtgttttatttagaagggtatgtttctagctagcagctcttaatc |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23265664 |
gagaatttactactgaaggataagccagtgattaatatcctaattaatttcttcagtgttttatttagaagggtatgtttctagctagcagctcttaatc |
23265565 |
T |
|
| Q |
203 |
taatgacgactataacatgccaaatattagtttt |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
23265564 |
taatgacgactataacatgccaaatattagtttt |
23265531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 3 - 88
Target Start/End: Complemental strand, 23246754 - 23246675
Alignment:
| Q |
3 |
gtgattgttgcagtgactgcgaaccctacttttctatttctggtttctttgttttcttcttggcaaggaaaggtacaaaagaagaa |
88 |
Q |
| |
|
||||||||||| |||||||||||||| ||||| ||||| |||||||||||||| |||||| |||||||| |||||||||| |
|
|
| T |
23246754 |
gtgattgttgccgtgactgcgaaccccgcttttatattt------tctttgttttcttcctggcaaagaaaggtagaaaagaagaa |
23246675 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University