View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1833_low_20 (Length: 227)
Name: NF1833_low_20
Description: NF1833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1833_low_20 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 42717328 - 42717102
Alignment:
| Q |
1 |
gacctgcaggaatggaacagttatgattaatacagtggagataacataaaaggaaattttttaagagaaataatatatgagtgtatctctttatttcact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42717328 |
gacctgcaggaatggaacagttatgattaatacagtggagataacatacaaggaaattttttaagagaaataatatatgagtgtatctctttatttcact |
42717229 |
T |
 |
| Q |
101 |
ccacgcagcaatactttgaaaagtcgggggattaatctcaccatgggccttctttaggacataaagtagactaacgagcacccaatttgaaattgaactt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42717228 |
ccacgcagcaatactttgaaaagtcgggggattaatctcaccatgggccttctttaggacataaagtagactaacgagcacccaatttgaaattgaactt |
42717129 |
T |
 |
| Q |
201 |
cttccggaatatcaaacaccaatcacc |
227 |
Q |
| |
|
||||||||||| ||||||||||||||| |
|
|
| T |
42717128 |
cttccggaataacaaacaccaatcacc |
42717102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University