View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1833_low_22 (Length: 218)
Name: NF1833_low_22
Description: NF1833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1833_low_22 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 7 - 218
Target Start/End: Original strand, 35108964 - 35109175
Alignment:
| Q |
7 |
tgttctcccttgatttccgagtaagaagaaatttaattggctgatatatgtcgagatatataacaaatgttggagtaactttcatccttttatcaagata |
106 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35108964 |
tgttctcccttgttttccgagtaagaagaaatttaattggctgatatatgtcgagatatataacaaatgttggagtaactttcatccttttatcaagata |
35109063 |
T |
|
| Q |
107 |
atgaagtaatgaccaattggtaaaaagtttttaccataatgtattgacattagagaatgtactgcgccatccatcccaaaataattatcctagtttgacc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
35109064 |
atgaagtaatgaccaattggtaaaaagtttttaccataatgtatcgacattagagaatgtactgcgccatccatcccaaaataattatcttagtttgacc |
35109163 |
T |
|
| Q |
207 |
atatctactatt |
218 |
Q |
| |
|
|||||||||||| |
|
|
| T |
35109164 |
atatctactatt |
35109175 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University