View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1833_low_6 (Length: 380)
Name: NF1833_low_6
Description: NF1833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1833_low_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 1 - 364
Target Start/End: Original strand, 38089442 - 38089797
Alignment:
| Q |
1 |
atataggagaaaatagcacaagcgaaactcaaagccaaaacatcgggctagttgaatcattggcctttatatatgatataaattcttcttaatgtgtatt |
100 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38089442 |
atataggagaaaatagctcaagcgaaactcaaagccaaaacattgagctagttgaatcattggcctttatatatgatataaattcttcttaatgtgtatt |
38089541 |
T |
 |
| Q |
101 |
gaacctcagaccacaacttacactttaattaatttattgaacttaatgatgtcaaagagttatttttcatatacattgcgnnnnnnnnnatatacacggt |
200 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
38089542 |
gaacctgagaccacaacttacact----ttaatttattgaacttaatgatgtcaaagagttatttttcatatacattgcgcttttttttatatacacggt |
38089637 |
T |
 |
| Q |
201 |
gcatataaaagaaaaatactccacttcattaagttttgtaaactatagtttaaattttggtcatatgtttaataccaaggaagaagaatttgtatnnnnn |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38089638 |
gcatataaaagaaaaatactccacttcattaagttttgtaaactatagtttaaattttggtcatatgtttaataccaaggaagaagaatttgtat----t |
38089733 |
T |
 |
| Q |
301 |
nnnnnnnnnaaggcattatattcatctaagatgttttagttttgagtcttgcttgtgctatttt |
364 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38089734 |
atatatataaaggcattatattcatctaagatgttttagttttgagtcttgcttgtgctatttt |
38089797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University