View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18340_low_1 (Length: 419)
Name: NF18340_low_1
Description: NF18340
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18340_low_1 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 1 - 397
Target Start/End: Complemental strand, 15633082 - 15632709
Alignment:
| Q |
1 |
tatgtcccattgttagaaatcacgagggatgttgctcaaaacctggcgagtatgtttattttgaagaaagaacatgctccatatgttcttcgccgtgatc |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| | || |||||||||||||||||| |
|
|
| T |
15633082 |
tatgtcacattgttagaaatcacgagggatgttgctcaaaaccttgcgggtatgtttattttgaagaaaggaa--gc-----atgttcttcgccgtgatc |
15632990 |
T |
|
| Q |
101 |
tttgttagggcttctgtttccatccacttcgtcgaataatccactgcgaccaccaggtagttgacttgtcccatagctttggggaatggtcccaatagat |
200 |
Q |
| |
|
|||||||||| ||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
15632989 |
tttgttagggattc----------------gtcgaataatccactacgaccaccaggtagttgacttgtcccatagctttggggaatggtcccgatagac |
15632906 |
T |
|
| Q |
201 |
cgattccacaccaagagaacggccatggtgaagcgaatgacattaactcggttggaggagctatgtgcatgtccccatgtttctggaatctgtggcatta |
300 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||||| | ||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
15632905 |
cgattccacaccaagcaaacggccatggtgaagcgaatgatgttaactcagctggaggagctatgtgcatgtccctatgtttctggaatctgtggcatta |
15632806 |
T |
|
| Q |
301 |
cataaacccaaaccattaccatcataaattagtcaaatattggataaattactagggcaatacaaaccaagctgcatatactgatataccacagaca |
397 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
15632805 |
cataaacccaaaccattaccatcataaattagtcaaatattggataaattactagggcaatacaaaccaagcagcatatactgatataccacagaca |
15632709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University