View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18340_low_4 (Length: 236)

Name: NF18340_low_4
Description: NF18340
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18340_low_4
NF18340_low_4
[»] chr1 (1 HSPs)
chr1 (134-220)||(37181641-37181727)


Alignment Details
Target: chr1 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 134 - 220
Target Start/End: Original strand, 37181641 - 37181727
Alignment:
134 tgggtcaattccgaaaaataactcttaagtcatggtgatggaaatggctcaattctacccaaaatattccacaaaatgggttaattc 220  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
37181641 tgggtcaattccgaaaaataactcttaagtcatggtgatggaaatggctcaattctacccaaaacattccacaaaatgggttaattc 37181727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University