View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18340_low_5 (Length: 204)
Name: NF18340_low_5
Description: NF18340
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18340_low_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 16 - 186
Target Start/End: Original strand, 7801850 - 7802020
Alignment:
| Q |
16 |
agagaatggaaaatatttcgttgcattgtaaggcatggttacaacgatgtaattggagattctatggagtttgagtctcaattggtgcaacatctaaagg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7801850 |
agagaatggaaaatatttcgttgcattgtaaggcatggttacaacgatgtaattggagattctatggagtttgagtctcaattggtgcaacatctaaagg |
7801949 |
T |
 |
| Q |
116 |
aatttattacacaagaaagtaagtatatgcttgatcttgaaaaaacaacaatatgtgaagaagatcgtgat |
186 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
7801950 |
aatttattacacaagaaagtaagtatatgtttgatcttgaaaaaacaacaaaatgtgaagaagatggtgat |
7802020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University