View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18341_low_8 (Length: 324)
Name: NF18341_low_8
Description: NF18341
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18341_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 148; Significance: 4e-78; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 160 - 319
Target Start/End: Complemental strand, 43357417 - 43357258
Alignment:
| Q |
160 |
gtgggcactccatgaacaatttattagacgggtatataccctatctaatggagacatttgatcgacttggtaacgcggattgggaggaatttacaacatg |
259 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43357417 |
gtgggcacaccatgaacaatttattagacgggtatataccctatctaatggacacatttgatcgacttggtaacgcggattgggaggaatttacaacatg |
43357318 |
T |
|
| Q |
260 |
tggcatgtgatataaatgaagcacttatttttgtgttaaaaagttaagtttgatgatgtc |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
43357317 |
tggcatgtgatataaatgaagcacttatttttgtgttaaaaagttaagtttgttgatgtc |
43357258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 19 - 131
Target Start/End: Complemental strand, 43357558 - 43357446
Alignment:
| Q |
19 |
ttatgtttattattaagaaaccaataagcagttgttaaaaaagtccaagcacttcaaattataggtgatcttagggttttaacttttaagacgagctaat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43357558 |
ttatgtttattattaagaaaccaataagcagttgttaaaaaagtccaagcacttcaaattataggtgatcttagggttttaacttttaagacgagctaat |
43357459 |
T |
|
| Q |
119 |
tattccattgaaa |
131 |
Q |
| |
|
||||||||||||| |
|
|
| T |
43357458 |
tattccattgaaa |
43357446 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University