View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18343_low_3 (Length: 436)
Name: NF18343_low_3
Description: NF18343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18343_low_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 366; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 366; E-Value: 0
Query Start/End: Original strand, 1 - 431
Target Start/End: Complemental strand, 28933439 - 28933016
Alignment:
| Q |
1 |
acatacatacatacatacatgtatgcaactatgctgaatgaaaaccaggggatcatatgttgttggcttatcattctactagacatgtgccgtggtcatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28933439 |
acatacatacatacatacatgtatgcaactatgctgaatgaaaaccagggaatcatatgttgttggcttatcattctactagacatgtgccgtggtcatt |
28933340 |
T |
|
| Q |
101 |
ttatttgagtatatatatcactctgctgcgtaatattgtcatccaaaatcttactctgaaaaaattgttgcagcatattatgatggaaacaagttcataa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28933339 |
ttatttgagtatatatatcactctgctgactaatattgtcatccaaaatctttctctgaaaaaattgttgcagcatattatgatggaaacaagttcataa |
28933240 |
T |
|
| Q |
201 |
caaatcaggatgggatatggatggtaagatacctctcaaactgaaaatacttcattattctattgatttaagcagttgttatcttttctcacaaatgcat |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
28933239 |
caaatcaggatgggatatggatggtaagatacctctcaaactgaaaatacttcattattctattgatttaagcagctgtta------ctcacaaatgcat |
28933146 |
T |
|
| Q |
301 |
tgaagtttttgtttgattt-catttgttgctttcttatcagtaagtcaaaagattttttaatgaattaaattaatttcagcttgatttctaacagggatc |
399 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28933145 |
tgaagtttttgtttgatttgcatttgttgctttcttatcaataagtc--aagattttttaatgaattaaattaatttcagcttgatttctaacagggatc |
28933048 |
T |
|
| Q |
400 |
aaacattttgggcaggccacacctttgcttct |
431 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
28933047 |
aaacattttgggcaggccacacctttgcttct |
28933016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University