View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18344_high_4 (Length: 239)

Name: NF18344_high_4
Description: NF18344
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18344_high_4
NF18344_high_4
[»] chr3 (1 HSPs)
chr3 (20-227)||(48923070-48923277)


Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 20 - 227
Target Start/End: Original strand, 48923070 - 48923277
Alignment:
20 ctggatagatgacttatgggaatcatcaactaccaattgtcttggctggaccaagtcaagctttgaagcttgagctgtaagccaattaattggtgaggac 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
48923070 ctggatagatgacttatgggaatcatcaactaccaattgtcttggctggaccaagtcaagctttgaagcttgagctgtacgccaattaattggtgaggac 48923169  T
120 gaggatgctggaactaaattatatgtaggggttgtttcactttggtttgaactagtgagtgacatttcaggttggtgatgtgcatggttgtgctctcctt 219  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48923170 gaggatgctggaactaaattatatgtaggggttgtttcactttggtttgaactagtgagtgacatttcaggttggtgatgtgcatggttgtgctctcctt 48923269  T
220 cgtctgtg 227  Q
    ||| ||||    
48923270 cgtatgtg 48923277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University