View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18344_high_6 (Length: 217)
Name: NF18344_high_6
Description: NF18344
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18344_high_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 15 - 200
Target Start/End: Original strand, 10590141 - 10590326
Alignment:
| Q |
15 |
cataggtggttcttactactttattttggcccaataataaattttcttaatgataaaaatggtagcaattcaatcttctatgacactagtctagccattt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
10590141 |
cataggtggttcttactactttattttggcccaataataaattttcttaatgataaaaatggtagcaattcaatcttctataacactagtctagccattt |
10590240 |
T |
 |
| Q |
115 |
cttgatttaatttctaacaattggtgcttgtgagccacatgccatggccaaatccatccaatgtttgtgtttttgaaggaaatagt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10590241 |
cttgatttaatttctaacaattggtgcttgtgagccacttgccatggccaaatccatccaatgtttgtgtttttgaaggaaatagt |
10590326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University