View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18344_low_6 (Length: 239)
Name: NF18344_low_6
Description: NF18344
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18344_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 20 - 227
Target Start/End: Original strand, 48923070 - 48923277
Alignment:
| Q |
20 |
ctggatagatgacttatgggaatcatcaactaccaattgtcttggctggaccaagtcaagctttgaagcttgagctgtaagccaattaattggtgaggac |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
48923070 |
ctggatagatgacttatgggaatcatcaactaccaattgtcttggctggaccaagtcaagctttgaagcttgagctgtacgccaattaattggtgaggac |
48923169 |
T |
|
| Q |
120 |
gaggatgctggaactaaattatatgtaggggttgtttcactttggtttgaactagtgagtgacatttcaggttggtgatgtgcatggttgtgctctcctt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48923170 |
gaggatgctggaactaaattatatgtaggggttgtttcactttggtttgaactagtgagtgacatttcaggttggtgatgtgcatggttgtgctctcctt |
48923269 |
T |
|
| Q |
220 |
cgtctgtg |
227 |
Q |
| |
|
||| |||| |
|
|
| T |
48923270 |
cgtatgtg |
48923277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University