View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18345_low_7 (Length: 237)
Name: NF18345_low_7
Description: NF18345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18345_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 22573213 - 22573434
Alignment:
| Q |
1 |
attacggaattaaataggatagtaaacttaaccctcagatttattattcatggacataatcttctgtatttgaaatcttatatcacatttagtgcaagtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22573213 |
attacggaattaaataggatagtaaacttaaccctcatatttattattcatggacataatcttctgtatttgaaatcttatatcacatttagtgcaagtt |
22573312 |
T |
 |
| Q |
101 |
tcatacaaatcaatactagaagatttagacagatccaaaagatgaaaatcactaaagaaaatctaaaatttatttcatatcttacaagcaaaatgttcaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22573313 |
tcatacaaatcaatactagaagatttagacagatccaaaagatgaaaatcactaagaaaaatctaaaatttatttcatatcttacaagcaaaatgttcaa |
22573412 |
T |
 |
| Q |
201 |
taaaataaattacatgacaact |
222 |
Q |
| |
|
||||| |||||||||||||||| |
|
|
| T |
22573413 |
taaaacaaattacatgacaact |
22573434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 117 - 172
Target Start/End: Original strand, 22563721 - 22563776
Alignment:
| Q |
117 |
tagaagatttagacagatccaaaagatgaaaatcactaaagaaaatctaaaattta |
172 |
Q |
| |
|
||||||||| ||||||| ||||||| ||||||| | |||| ||||||||||||||| |
|
|
| T |
22563721 |
tagaagattaagacagacccaaaaggtgaaaattaataaacaaaatctaaaattta |
22563776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University