View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18346_low_14 (Length: 271)
Name: NF18346_low_14
Description: NF18346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18346_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 178; Significance: 4e-96; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 182
Target Start/End: Complemental strand, 22682272 - 22682091
Alignment:
| Q |
1 |
gcaatatctgagaataaaatcagacccctattgttggtaattactttatatttgcaaatgcatttgactaaatttcactaaatgcatggcccaacttatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22682272 |
gcaatatctgagaataaaatcagacccctattgttggtaattactttatatttgcaaatgcatttgactaaatttcactaaatgcatggcccaacttatg |
22682173 |
T |
 |
| Q |
101 |
accaataaatataacctacctcaaacttcactgatccacgatcgatgatgcagttcacttttttaagaatgtcaggctctgc |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
22682172 |
accaataaatataacctacctcaaacttcactgatccacgatcgacgatgcagttcacttttttaagaatgtcaggctctgc |
22682091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 179 - 224
Target Start/End: Complemental strand, 22681908 - 22681863
Alignment:
| Q |
179 |
ctgccagagattggtgtatttattgtcaaagatatagtgtgtgtta |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22681908 |
ctgccagagattggtgtatttattgtcaaagatatagtgtgtgtta |
22681863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 222 - 263
Target Start/End: Complemental strand, 22681742 - 22681701
Alignment:
| Q |
222 |
ttaaataaagaatttcaacttaccaactgcaattggatctgt |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22681742 |
ttaaataaagaatttcaacttaccaactgcaattggatctgt |
22681701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 221 - 264
Target Start/End: Original strand, 21211743 - 21211786
Alignment:
| Q |
221 |
gttaaataaagaatttcaacttaccaactgcaattggatctgtg |
264 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21211743 |
gttagataaagaatttcaacttaccaactgcaattggatctgtg |
21211786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 72 - 182
Target Start/End: Original strand, 21210578 - 21210688
Alignment:
| Q |
72 |
atttcactaaatgcatggcccaacttatgaccaataaatataacctacctcaaacttcactgatccacgatcgatgatgcagttcacttttttaagaatg |
171 |
Q |
| |
|
|||| |||||||||| |||||||||| | | |||||| |||||||||||||| ||||||||||| |||| | | | ||||||| |||||||| | |
|
|
| T |
21210578 |
atttaactaaatgcaaagcccaacttaggtctgataaatctaacctacctcaaatttcactgatcccagatcaaggttctgcttcacttctttaagaacg |
21210677 |
T |
 |
| Q |
172 |
tcaggctctgc |
182 |
Q |
| |
|
||||||||||| |
|
|
| T |
21210678 |
tcaggctctgc |
21210688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University