View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18346_low_20 (Length: 211)
Name: NF18346_low_20
Description: NF18346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18346_low_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 46 - 203
Target Start/End: Complemental strand, 38184440 - 38184283
Alignment:
| Q |
46 |
ggtgaaatctttgtgttcccaaaaggattggtgcattatcagaagaataatggggataaagctgcttctgtgatttctgcttttaacagtcaacttcctg |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
38184440 |
ggtgaaatctttgtgttcccaaaaggattggtgcattatcagaagaataatggggataaagctgcttctgtgatttctgcttttaatagtcaacttcctg |
38184341 |
T |
 |
| Q |
146 |
gtactttgtcaattgtttcatctctgtttgactctacaccaactgttcctgatgatgt |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38184340 |
gtactttgtcaattgtttcatctctgtttgactctacaccaactgttcctgatgatgt |
38184283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University