View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18346_low_23 (Length: 203)
Name: NF18346_low_23
Description: NF18346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18346_low_23 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 16 - 160
Target Start/End: Complemental strand, 45891460 - 45891316
Alignment:
| Q |
16 |
ttattctcaaattattttcagggcttgtggttgaactttacaaaggatcagttattttgtcttttaggaccgaatggagctggaaagactacagttatta |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45891460 |
ttattctcaaattattttcagggcttgtggttgaactttacaaaggatcagttattttgtcttttaggaccgaatggagctggaaagactacagttatta |
45891361 |
T |
|
| Q |
116 |
attgtttgacagggataactccagtaacagatggagatggtgata |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45891360 |
attgtttgacagggataactccagtaacagatggagatggtgata |
45891316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 16 - 160
Target Start/End: Original strand, 12982901 - 12983045
Alignment:
| Q |
16 |
ttattctcaaattattttcagggcttgtggttgaactttacaaaggatcagttattttgtcttttaggaccgaatggagctggaaagactacagttatta |
115 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||||||||| ||||||||||||||||||| ||||| |||||||| ||||| ||||||| ||||| |
|
|
| T |
12982901 |
ttattctcaaattactttcagggcttgtgggtgaactttacaaagaatcagttattttgtcttttgggacccaatggagcgggaaaaactacagctatta |
12983000 |
T |
|
| Q |
116 |
attgtttgacagggataactccagtaacagatggagatggtgata |
160 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
12983001 |
gttgtttgacagggataactccagtaactgatggagatggtgata |
12983045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University