View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18346_low_4 (Length: 632)
Name: NF18346_low_4
Description: NF18346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18346_low_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 545; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 545; E-Value: 0
Query Start/End: Original strand, 1 - 565
Target Start/End: Complemental strand, 48286815 - 48286251
Alignment:
| Q |
1 |
agcacttttcaacttcctcctttgtttctcattcaactcctcatgtctaaccttcgtttccgccttcaccgccgtcttattcttcaccttcacatcaaac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48286815 |
agcacttttcaacttcctcctttgtttctcattcaactcctcatgtctaaccttcgtttcccccttcaccgccgtcttattcttcaccttcacatcaaac |
48286716 |
T |
 |
| Q |
101 |
gcagccaccttcgtcgatcctaaattcaaatcaccattatctgcccatatctgaacactactttgttcaaaacgccacaccatttttgcattacggttct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48286715 |
gcagccaccttcgtcgatcctaaattcaaatcaccattatctgcccatatctgaacactactttgttcaaaacgccacaccatttttgcattacggttct |
48286616 |
T |
 |
| Q |
201 |
tcacttccaccattgttaccgtgtttgcgtcgagataagcaccgtcggattttgtggttatgttgaaacttggaacacggaaggaaccgaggtggaattc |
300 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
48286615 |
tcacttccaccattgttatcgtgtttgcgtcgagataagcaccgtcggattttgtggttatgttgaaacttggaacacggaaagaaccgaggtggaattc |
48286516 |
T |
 |
| Q |
301 |
tggtatggaaggttgatagagaatgtagataactgcggcggcgaggatgaaaaggaagaagagaatgaggaagatgatgcaaaatgtgcaacaacatagg |
400 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
48286515 |
tggtatggaaggttggtagagaatgtagataactgcggcggcgaggatgaaaaggaagaagagaatgaggaagatgatgcaaaatgtgcaacaaaatagg |
48286416 |
T |
 |
| Q |
401 |
cgacaataattacgtttcttgggttttggtcggaaagaaggtgggagagaagggtttcgtgttggaagcggtttttgttggatgtttgggtctctataac |
500 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48286415 |
cgacaataattacgtttcttgggttttggtcggaaagaaggtgggagagaagggtttcgtgttggaagcggtttttgttggatgtttgggtctctataac |
48286316 |
T |
 |
| Q |
501 |
aaggtggttttggtagtattattggtttttgttcgggcgatggttgctgcattgtgattttgtgt |
565 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48286315 |
aaggtggttttggtagtattattggtttttgttcgggcgatggttgctgcattgtgattttgtgt |
48286251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University