View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18346_low_7 (Length: 389)
Name: NF18346_low_7
Description: NF18346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18346_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 320; Significance: 1e-180; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 320; E-Value: 1e-180
Query Start/End: Original strand, 38 - 373
Target Start/End: Complemental strand, 46169415 - 46169080
Alignment:
| Q |
38 |
aaatgctgacacacaaccaccgccatcacatggcttcttcaccttcttcattcttcaacattttcactctattcttattactattgcaacactccctaat |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
46169415 |
aaatgctgacacacaaccaccgccatcacatggcttcttcaccttcttcattcttcaacattttcactctattcttattactattgcaacactccccaat |
46169316 |
T |
|
| Q |
138 |
cattgtagttgcatttacagaaactagtccgcccccaactcccattcccgaagacgcaaccaccattgctcaatctcaacctcaacacactgttacacca |
237 |
Q |
| |
|
| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46169315 |
cgttgtagttgcatttacagaaactagtccacccccaactcccattcccgaagacgcaaccaccattgctcaatctcaacctcaacacactgttacacca |
46169216 |
T |
|
| Q |
238 |
ttcaaaccaagcgtagctattgttattggtgttttcactatcctcttctctctcacctttctccttcttctctacattaagcacatcaacaacagcaaca |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
46169215 |
ttcaaaccaagcgtagctattgttattggtgttttcactatcctcttctctctcacctttctccttcttctctacattaaacacatcaacaacagcaaca |
46169116 |
T |
|
| Q |
338 |
ccaccggtgagacaattaacattgacagtagtagct |
373 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
46169115 |
ccaccggtgagacaattaacattgacagtagtagct |
46169080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University