View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18347_high_20 (Length: 285)
Name: NF18347_high_20
Description: NF18347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18347_high_20 |
 | |
|
| [»] scaffold0013 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0013 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: scaffold0013
Description:
Target: scaffold0013; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 14 - 148
Target Start/End: Original strand, 44072 - 44206
Alignment:
| Q |
14 |
cattatcatcacagcttcccagtctctactttcctccaaattcaacaaacacccctgaactatctaaaaaatttatcatacttttcgcccctgaactcgt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44072 |
cattatcatcacagcttcccagtctctactttcctccaaattcaacaaacacccctgaactatctaaaaaatttatcatacttttcgcccctgaactcgt |
44171 |
T |
|
| Q |
114 |
tgattttttgtaaccccttcccaaacttaagatgt |
148 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
44172 |
tgattttttgtaaccccttcccaaacttaagatgt |
44206 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 126 - 273
Target Start/End: Original strand, 23690021 - 23690166
Alignment:
| Q |
126 |
accccttcccaaacttaagatgttgttgattctaaacaacaaccccaattttagattcaaaccattaataagtatctatgattctatctaactgcaaaga |
225 |
Q |
| |
|
||||| |||||||||||| |||||| | ||| || || ||||||||| |||| ||||||||| || ||||| ||||| ||||||||||| |||||| |
|
|
| T |
23690021 |
accccatcccaaacttaaaatgttgctagttccaa-cagcaaccccaaacttagtttcaaaccaataccaagtacctatggctctatctaactccaaaga |
23690119 |
T |
|
| Q |
226 |
aataaagcagatacaacattatggcttcaaaaacttgtaacatggttc |
273 |
Q |
| |
|
||| || |||||| || || ||| ||| ||||||||| ||||||||| |
|
|
| T |
23690120 |
aattaaacagatataatatagtgggttc-aaaacttgtgacatggttc |
23690166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University