View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18347_high_22 (Length: 279)
Name: NF18347_high_22
Description: NF18347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18347_high_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 17 - 270
Target Start/End: Complemental strand, 19134993 - 19134739
Alignment:
| Q |
17 |
atggacgttgtgcaacagtcctgaaaccgtttattaatctacttgaatagttgcatgaagtgtgtctatatagtaaagaaccattatatacatgcctact |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19134993 |
atggacgttgtgcaacagtcctgaaaccgtttattaatctacttgaatagttgcatgaagtgtgtctatatagtaaagaaccattatatacatgcctact |
19134894 |
T |
 |
| Q |
117 |
tttactaattaacaatgtctttaagttaaattagggttcttcagactgtgaactggaaaagaaccagcatttgctaccatacctcatgataatactatta |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
19134893 |
tttactaattaacaatgtctttaagttaaattagggttcttcagactgtgaactggaaaagaaccagcatttgcgaccatacctcatgataatactatta |
19134794 |
T |
 |
| Q |
217 |
tcgtatcttttaataac-aactagtttctaaaccttactctttgtatttctctgc |
270 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19134793 |
tcgtatcttttaataacaaactagtttctaaaccttactctttgtatttctctgc |
19134739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University