View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18347_high_23 (Length: 275)
Name: NF18347_high_23
Description: NF18347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18347_high_23 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 261; Significance: 1e-145; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 1 - 265
Target Start/End: Original strand, 3892713 - 3892977
Alignment:
| Q |
1 |
tgtttaatgaaacaggacttagtttaatttgtgattaattatgatggatgcaatggagaaaaattcaagagatgttgagagtgatgaaaaatttgaattg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3892713 |
tgtttaatgaaacaggacttagtttaatttgtgattaattatgatggatgcaatggagaaaaattcaagagatgttgagagtgatgaaaaatttgaattg |
3892812 |
T |
 |
| Q |
101 |
ccacctggatttaggtttcatccaacagatgaagaactcataactcattacctctctcaaaaagttcttgataattctttttgtgctatagccattggtg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3892813 |
ccacctggatttaggtttcatccaacagatgaagaactcataactcattacctctctcaaaaagttcttgataattctttttgtgctatagccattggtg |
3892912 |
T |
 |
| Q |
201 |
aagctgatttgaacaagtgtgagccttgggatttgccttgtaagtttctcttctcattacctttg |
265 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3892913 |
aagctgatttgaacaagtgcgagccttgggatttgccttgtaagtttctcttctcattacctttg |
3892977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 104 - 141
Target Start/End: Complemental strand, 31607242 - 31607205
Alignment:
| Q |
104 |
cctggatttaggtttcatccaacagatgaagaactcat |
141 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
31607242 |
cctggttttaggtttcatccaacagatgaagaactcat |
31607205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 194 - 234
Target Start/End: Complemental strand, 10318111 - 10318071
Alignment:
| Q |
194 |
attggtgaagctgatttgaacaagtgtgagccttgggattt |
234 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
10318111 |
attggtgaagctgatttgaataggtgtgagccttgggattt |
10318071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 194 - 231
Target Start/End: Original strand, 32990848 - 32990885
Alignment:
| Q |
194 |
attggtgaagctgatttgaacaagtgtgagccttggga |
231 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32990848 |
attggtgaagctgatttgaacaagtgtgaaccttggga |
32990885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 110 - 246
Target Start/End: Complemental strand, 11463783 - 11463647
Alignment:
| Q |
110 |
tttaggtttcatccaacagatgaagaactcataactcattacctctctcaaaaagttcttgataattctttttgtgctatagccattggtgaagctgatt |
209 |
Q |
| |
|
||||||||||||||||| |||||||| ||||| | ||||||||| | | |||| || |||| | || | ||||| |||||||| |||| |||| |
|
|
| T |
11463783 |
tttaggtttcatccaactgatgaagagctcattagtcattacctttataaaaaggtaattgacataaacttctctgctagggccattggagaagtggatt |
11463684 |
T |
 |
| Q |
210 |
tgaacaagtgtgagccttgggatttgccttgtaagtt |
246 |
Q |
| |
|
||||||| | |||||||||||||||||| |||||||| |
|
|
| T |
11463683 |
tgaacaaatctgagccttgggatttgccatgtaagtt |
11463647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 179 - 237
Target Start/End: Complemental strand, 31359684 - 31359626
Alignment:
| Q |
179 |
ttttgtgctatagccattggtgaagctgatttgaacaagtgtgagccttgggatttgcc |
237 |
Q |
| |
|
|||||||||||||| |||| ||||| |||| |||| |||||||| || ||||||||||| |
|
|
| T |
31359684 |
ttttgtgctatagctattgctgaagttgatatgaataagtgtgaaccgtgggatttgcc |
31359626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University