View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18347_high_31 (Length: 209)
Name: NF18347_high_31
Description: NF18347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18347_high_31 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 2 - 190
Target Start/End: Complemental strand, 27142338 - 27142150
Alignment:
| Q |
2 |
gaaaaatgtttttgaaaattaattaacgaggaatacttaacctgcagtggccaataaacacacacgatcagttatcagtgtcggctttagtgatctgagg |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
27142338 |
gaaaaatgtttttgaaaattaattaacgaggaatacttaacctgcagtggccaataaacacacacgttcagttatcagtgtcggctttagtggtctgagc |
27142239 |
T |
|
| Q |
102 |
aaatattttggaaaagggtactaaggtactttcaccttgtccttataaataggccaaactcaccttactccttcattctatcgcttcat |
190 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
27142238 |
aaatattttagaaaagggtactaaggtactttcaccttgtccttataaataggccaaactcacctaactccttcattctatctcttcat |
27142150 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University