View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18347_low_24 (Length: 272)
Name: NF18347_low_24
Description: NF18347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18347_low_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 166; Significance: 6e-89; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 89 - 262
Target Start/End: Complemental strand, 27142083 - 27141910
Alignment:
| Q |
89 |
cattatccacacttttcttcccaaatcaatgaaaatcaaaccttatgtgtgtggaattgatcaacttcttcatttgggtcaaagggtaagacaaaattat |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
27142083 |
cattatccacacttttcttcccaaatcaatgaaaatcaaaccttatgtgtgtggaattgatcaacttcttcatttgggtcaaagggtaacacaaaattat |
27141984 |
T |
 |
| Q |
189 |
ttttcccctttcattcctatggtaagcgaaaccccatcattccacaacttgtcaaatcttcacttcctcctttg |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27141983 |
ttttcccctttcattcctatggtaagcgaatccccatcattccacaacttgtcaaatcttcacttcctcctttg |
27141910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 27142166 - 27142128
Alignment:
| Q |
1 |
tcattctatcgcttcatttctctcactagctaaagacta |
39 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
27142166 |
tcattctatctcttcatttctctcactagctaaagacta |
27142128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University