View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18347_low_35 (Length: 201)
Name: NF18347_low_35
Description: NF18347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18347_low_35 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 144; Significance: 6e-76; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 144; E-Value: 6e-76
Query Start/End: Original strand, 11 - 177
Target Start/End: Complemental strand, 14510651 - 14510482
Alignment:
| Q |
11 |
agtgaaaagaaaattgaaagcaaaatcacggagaatcacataaatagcaacaaaaatgaagatcaaagttcaaataattcacaatgatgaaagtccaatg |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14510651 |
agtggaaagaaaattgaaagcaaaatcatggagaatcacataaatagcaacaaaaatgaagatcaaagttcaaataattcacaatgatgaaagtccaata |
14510552 |
T |
 |
| Q |
111 |
gttgcta---ctacatgttggttttttaataggtgcttagggtgtccttatacatgtgcataatgtttgt |
177 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14510551 |
gttgctactactacatgttggttttttaataggtgcttagggtgtccttatacatgtgcataatgtttgt |
14510482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University