View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18349_high_11 (Length: 247)
Name: NF18349_high_11
Description: NF18349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18349_high_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 15 - 231
Target Start/End: Complemental strand, 43350022 - 43349806
Alignment:
| Q |
15 |
cataggtgattacgactgacagggatatcacattgatgaattttgtcgccactgctttttctaaaactaccgcattattttgtcagattcatatttctcc |
114 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
43350022 |
cataggtgattatgactgacatggatatcacattgatgaattttgtcgccactgttttttctaaaactactgcattattttgtcagattcatatttctcc |
43349923 |
T |
 |
| Q |
115 |
ccggtgtggtgtatactttcaagtatcacaatgacacctctattcctccaaccatggattggagggataaaggtgaattaactccaatcaaaaggcaagg |
214 |
Q |
| |
|
||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
43349922 |
ccgatgtggtgtatactttcaagtatcacaatgccacctctattcctccaaccatggattggagggataaaggtgcattaactccaatcaaaaggcaagg |
43349823 |
T |
 |
| Q |
215 |
aaattgtggtatgtata |
231 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
43349822 |
aaattgtggtatgtata |
43349806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 18 - 108
Target Start/End: Original strand, 31446101 - 31446191
Alignment:
| Q |
18 |
aggtgattacgactgacagggatatcacattgatgaattttgtcgccactgctttttctaaaactaccgcattattttgtcagattcatat |
108 |
Q |
| |
|
|||||||| ||| |||| ||||||||||||||||||| |||||||| || ||| || |||||||||||||| ||||||| ||||||| |
|
|
| T |
31446101 |
aggtgattgtgacagacaaggatatcacattgatgaatgatgtcgccattgttttcccttaaactaccgcattactttgtcaatttcatat |
31446191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 28 - 112
Target Start/End: Complemental strand, 13675811 - 13675727
Alignment:
| Q |
28 |
gactgacagggatatcacattgatgaattttgtcgccactgctttttctaaaactaccgcattattttgtcagattcatatttct |
112 |
Q |
| |
|
|||||||||| |||||||| | |||||| |||| | || || ||| ||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
13675811 |
gactgacaggaatatcacactaatgaatgttgttgtcattgttttcactaaaactattgcattagtttgtcagattcatatttct |
13675727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University