View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18349_high_7 (Length: 402)
Name: NF18349_high_7
Description: NF18349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18349_high_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 352; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 352; E-Value: 0
Query Start/End: Original strand, 1 - 385
Target Start/End: Complemental strand, 1248360 - 1247976
Alignment:
| Q |
1 |
aatcaagaacaagaccaaattacttggcttgttctcccacattgtacatttattaataataatcattgaaaatgggcaactgtgctggcaaccctaggac |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1248360 |
aatcaagaacaagaccaacttacttggcttgttctcccacattgtacatttattaataataatcattgaaaatgggcaactgtgctggcaaccctaggac |
1248261 |
T |
 |
| Q |
101 |
cgacgaaagtgacgctccagtccctgtccccgagcctgtcaccgaggaggttaaggttgaacagcaagccaaggagaccaaagctgaggagaccgttaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1248260 |
cgacgaaagtgacgctccagtccctgtccctgagcctgtcaccgaggaggttaaggttgaacagcaagccaaggagaccaaagctgaggagaccgttaag |
1248161 |
T |
 |
| Q |
201 |
gcctccgacgataagtctctaggcaccttgctcagtgaggtatgtattcttatataagcaatcatattcatgcacataaatccgatattgaatatccaac |
300 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1248160 |
gcctctgacgataagtctctaggcaccttgctcagtgaggtatgtattcttatataagcaatcatattcatgcacataaatccgatattgaatatccaac |
1248061 |
T |
 |
| Q |
301 |
accatatagttnnnnnnntgactaagtataaaatagtcattcgtgaaattttcggtattgttatctctcgccataactagcaatt |
385 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1248060 |
accatatagttaaaaaaatgactaagtataaaatagtcattcgtgaaattttcggtattgttatctctcgccataactagcaatt |
1247976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University