View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18349_low_15 (Length: 229)
Name: NF18349_low_15
Description: NF18349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18349_low_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 15 - 214
Target Start/End: Complemental strand, 37315326 - 37315127
Alignment:
| Q |
15 |
aagaacagttttggtttgtttagtaaggagtttcttagaagacacggtcttcatctgcttggaacaacttccacttggtttcttcttgatattgcttatt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37315326 |
aagaacagttttggtttgtttagtaaggagtttcttagaagacacggtcttcatctgcttggaacaacttccacttggtttcttcttgatattgcttatt |
37315227 |
T |
 |
| Q |
115 |
atagttcgaatctttttcaaaaagatatttatagtagtattggttggcttccaccagcacaagatatgaatgcaattcatgaagttttcaaagttgctag |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37315226 |
atagttcgaatctttttcaaaaagatatttatagtagtattggttggcttccaccagcacaagatatgaatgcaattcatgaagttttcaaagttgctag |
37315127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 57 - 142
Target Start/End: Complemental strand, 30620229 - 30620144
Alignment:
| Q |
57 |
cacggtcttcatctgcttggaacaacttccacttggtttcttcttgatattgcttattatagttcgaatctttttcaaaaagatat |
142 |
Q |
| |
|
|||||| | ||||||||||||||| | ||||| |||||| | ||||||||||| | ||| ||| ||||||||| ||||| ||||| |
|
|
| T |
30620229 |
cacggtttgcatctgcttggaacagcatccacatggtttttgcttgatattgcattttacagtcagaatcttttccaaaaggatat |
30620144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University