View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18349_low_16 (Length: 218)
Name: NF18349_low_16
Description: NF18349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18349_low_16 |
 | |
|
| [»] scaffold0176 (1 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 199
Target Start/End: Complemental strand, 38644001 - 38643803
Alignment:
| Q |
1 |
ttttgcatttgggtcattgtttcttgtgtcaaataaggaacttgttggggtttagaaattggtgtttctttttcaaatagaacctctttcacagattcct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
38644001 |
ttttgcatttgggtcattgtttcttgtgtcaaataaggaacttgttggggtttagaaattggtgtttctttttcaaatagtacctctttcacagattcct |
38643902 |
T |
|
| Q |
101 |
cttcaacaatacgtggtggtgattttgactgagaagaagaagattgatacaatagtgttcgttctaatatgatgggagagtggaacagaagttctgggt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
38643901 |
cttcaacaatacgtggtggtgattttgactgagaagaagaagattgatacaatagtgttcgttctaatatgatgggagagtggaacagaagttatgggt |
38643803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 104; Significance: 5e-52; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 1 - 128
Target Start/End: Complemental strand, 38235399 - 38235272
Alignment:
| Q |
1 |
ttttgcatttgggtcattgtttcttgtgtcaaataaggaacttgttggggtttagaaattggtgtttctttttcaaatagaacctctttcacagattcct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
38235399 |
ttttgcatttgggtcattgtttcttgtgtcaaatttggaacttgttggggtttggaaattggtgtttctgtttcaaatagaacttctttcacagattcct |
38235300 |
T |
|
| Q |
101 |
cttcaacaatacgtggtggtgattttga |
128 |
Q |
| |
|
||||||||||| |||||||||||||||| |
|
|
| T |
38235299 |
cttcaacaatatgtggtggtgattttga |
38235272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176 (Bit Score: 49; Significance: 3e-19; HSPs: 1)
Name: scaffold0176
Description:
Target: scaffold0176; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 37 - 109
Target Start/End: Original strand, 16831 - 16903
Alignment:
| Q |
37 |
ggaacttgttggggtttagaaattggtgtttctttttcaaatagaacctctttcacagattcctcttcaacaa |
109 |
Q |
| |
|
||||||||||||||||| |||||||||||||| | ||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
16831 |
ggaacttgttggggtttgaaaattggtgtttctatgtcaaatagaacttctttcacagattcctctgcaacaa |
16903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 54
Target Start/End: Complemental strand, 37609699 - 37609646
Alignment:
| Q |
1 |
ttttgcatttgggtcattgtttcttgtgtcaaataaggaacttgttggggttta |
54 |
Q |
| |
|
|||||||| ||||||||| |||||| |||||||| ||||||||||| |||||| |
|
|
| T |
37609699 |
ttttgcatatgggtcattatttcttatgtcaaatttggaacttgttgaggttta |
37609646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University