View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1834_high_28 (Length: 206)
Name: NF1834_high_28
Description: NF1834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1834_high_28 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 19 - 191
Target Start/End: Complemental strand, 43552686 - 43552510
Alignment:
| Q |
19 |
agaaacgctaggaaatttccctttcatattgcagcatat----ttaaacttctgctactattacatgaaaccttaaagcaagaaaaatggatttcaacag |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| ||||||| || ||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
43552686 |
agaaacgctaggaaatttccctttcatattgcagcatatatatttaaatttctgcttctgttacatgaaaccttaaagcaagaaaaatggatttcaatag |
43552587 |
T |
 |
| Q |
115 |
taacatatatatgtgctgtagaaaaataatatgatataatgcactatatttcttggttgattttgacccttcttaat |
191 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| |||| ||||| |||||||||||||||||||||| |
|
|
| T |
43552586 |
taacatatatattggctgtagaaaaataatatgatataatgcattatacttcttagttgattttgacccttcttaat |
43552510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University