View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1834_high_7 (Length: 344)
Name: NF1834_high_7
Description: NF1834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1834_high_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 17 - 339
Target Start/End: Original strand, 14192966 - 14193294
Alignment:
| Q |
17 |
ctcatatacttgattttatgcacttttctactgtgacagacagccggattagagatgcaaagccagcaaggcaagagctagttcgatgcgctactaagct |
116 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
14192966 |
ctcatatacttgatttaatgcacttttctactgtggaagacagccggattagagatgcaaagccagcaaggcaagagctagttcgatgcgctactagtct |
14193065 |
T |
|
| Q |
117 |
tctagctgctgggataatcatcattccagtac---gccaggtgcnnnnnnntccggaggtaattgatttgacggatacattcgactttaatataagtttt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| |||| ||| ||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
14193066 |
tctagctgctgggataatcatcattccagtaccctgcctggtggaacgaaatccccaggtacttgatttgacggatacattcgactttaatatacgtttg |
14193165 |
T |
|
| Q |
214 |
gacgataca---gggaagctaggaatcccggtgttgaatgtcaaggaaacaacggaagtgaggtggaggaatttgattgcttgggagcagagcaaaatta |
310 |
Q |
| |
|
||| ||| | ||| ||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14193166 |
gactatataacgggggagctacgaatcccggtgttgaatttcaaggaaacaacggaagtgaggtggaggaatttgattgcttgggagcagagcaaaatta |
14193265 |
T |
|
| Q |
311 |
acattaaatgcaaatatacatcctatgct |
339 |
Q |
| |
|
|||||| |||||||||||||||||||||| |
|
|
| T |
14193266 |
acattagatgcaaatatacatcctatgct |
14193294 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 243 - 301
Target Start/End: Original strand, 18521891 - 18521949
Alignment:
| Q |
243 |
gttgaatgtcaaggaaacaacggaagtgaggtggaggaatttgattgcttgggagcaga |
301 |
Q |
| |
|
|||| |||| ||||||||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
18521891 |
gttgtatgttaaggaaacaacggaagtgaagtggaggaatttgattgcttgggaacaga |
18521949 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 51; Significance: 3e-20; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 256 - 338
Target Start/End: Original strand, 4591407 - 4591489
Alignment:
| Q |
256 |
gaaacaacggaagtgaggtggaggaatttgattgcttgggagcagagcaaaattaacattaaatgcaaatatacatcctatgc |
338 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| ||||||| | |||| ||||||||| ||||||||||| |
|
|
| T |
4591407 |
gaaacaacggaagtgaagtggaggaatttgattgcttgggagcaaagcaaaaattggattagatgcaaatacacatcctatgc |
4591489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 253 - 338
Target Start/End: Original strand, 4555103 - 4555188
Alignment:
| Q |
253 |
aaggaaacaacggaagtgaggtggaggaatttgattgcttgggagcagagcaaaattaacattaaatgcaaatatacatcctatgc |
338 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||||||||||||||||| ||||||||| | |||||||||||| || |||||||| |
|
|
| T |
4555103 |
aaggaaagaacggaagtgaagtggaggaatttgattgcttgggagcaaagcaaaatttggagtaaatgcaaatacacttcctatgc |
4555188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 251 - 309
Target Start/End: Original strand, 4620934 - 4620992
Alignment:
| Q |
251 |
tcaaggaaacaacggaagtgaggtggaggaatttgattgcttgggagcagagcaaaatt |
309 |
Q |
| |
|
||||||||||||| ||||| | ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
4620934 |
tcaaggaaacaactgaagttaagtggaggaatttgattgcttgggagcaaagcaaaatt |
4620992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University