View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1834_low_11 (Length: 247)
Name: NF1834_low_11
Description: NF1834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1834_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 48 - 231
Target Start/End: Original strand, 28188631 - 28188823
Alignment:
| Q |
48 |
aataacaagtaacttttgcatatgtacgtgtttattgaacacaaataatccaaaatttatgaaaaatatcaaaataattcaattatgacttttgatattt |
147 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28188631 |
aataacaagtaacttttgcatacgtacgtgtttattgaacacaaataatccaaaatttatgaaaaatatcaaaataattcaattatgacttttgatattt |
28188730 |
T |
|
| Q |
148 |
gttgttattattttgatgtattttgaacttttgattagttgtacctaatg---------tatgtatacaatatttgtattgaaaggatacata |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
28188731 |
gttgttattattttgatgtattttgaacttttgattagttgtacctaatgtatatatattatgtatacaatatttgtattgaaaggatacata |
28188823 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 28188553 - 28188602
Alignment:
| Q |
1 |
gcttcaacttttgacttatgagtacgtataacttgtctccacatgcaaat |
50 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28188553 |
gcttcaacttttgacttatgagtacgtataacttgtctccacatgcaaat |
28188602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University