View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1834_low_12 (Length: 244)
Name: NF1834_low_12
Description: NF1834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1834_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 1 - 108
Target Start/End: Original strand, 28188191 - 28188298
Alignment:
| Q |
1 |
aaagaaaaatactaactacacattatcgaccatatattttataatatttgagagagaattttttgaaaattatatgttaaaagtgtgttgttaatactta |
100 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28188191 |
aaagaaaaatactaactacacattatccaccatatattttataatatttgagagagaatttgttgaaaattatatgttaaaagtgtgttgttaatactta |
28188290 |
T |
|
| Q |
101 |
atactcat |
108 |
Q |
| |
|
|||||||| |
|
|
| T |
28188291 |
atactcat |
28188298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 86 - 230
Target Start/End: Original strand, 28188343 - 28188469
Alignment:
| Q |
86 |
tgttgttaatacttaatactcatattgctaaagtaatacaatttttagattattggtaatactattatgtgatctcacggcctcttaaactttcactctc |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
28188343 |
tgttgttaatacttaatactcatattgctaaagtaatacaatttttagattattg------------------ctcacggcctcttaaactttcactctc |
28188424 |
T |
|
| Q |
186 |
tttatttatttatttttctaaaggagatgatgccaataacaaata |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28188425 |
tttatttatttatttttctaaaggagatgatgccaataacaaata |
28188469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University