View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1834_low_13 (Length: 243)
Name: NF1834_low_13
Description: NF1834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1834_low_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 11 - 227
Target Start/End: Original strand, 36605114 - 36605330
Alignment:
| Q |
11 |
cataggtcatagcaaagaaagtactgaggtgtaatcttccttgtttttcataagcagcaaggtccatatggaaattagagtctattatttctgtgatatt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36605114 |
cataggtcatagcaaagaaagtactgaggtgtaatcttccttgtttttcataagcagcaaggtccatatggaaattagagtctattatttctgtgatatt |
36605213 |
T |
 |
| Q |
111 |
gtaaatctcaccttttgaagtaaaaagttgattagagaaaattggaaaggttttggcattgtaaacattgaaccaatagcacaatggagtgagaatgtac |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36605214 |
gtaaatctcaccttttgaagtaaaaagttgattagagaaaattggaaatgttttggcattgtaaacattgaaccaatagcacaatggagtgagaatgtac |
36605313 |
T |
 |
| Q |
211 |
ataacaaacacaaatcc |
227 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
36605314 |
ataacaaacacaaatcc |
36605330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University