View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1834_low_15 (Length: 236)
Name: NF1834_low_15
Description: NF1834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1834_low_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 20 - 225
Target Start/End: Complemental strand, 23142319 - 23142114
Alignment:
| Q |
20 |
ctatgaggccgacacatatttatcggaagatatcttacgatagtgtannnnnnncttctttttgcgtatggcaagatatcttccgatgatgtattttgcc |
119 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23142319 |
ctatgaggccgccacatatttatcggaagatatcctacgatagtgtatttttttattctttttgcgtatggcaagatatcttccgatgatgtattttgcc |
23142220 |
T |
|
| Q |
120 |
taaaaatctttatggctggtcgatattaacatactggctcaaagtcatgtttggcgaataggccgcagaaagaacttttctcactactcatactacttca |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
23142219 |
taaaaatctttatggctggtcgatattaacatactggctcaaagtcatgtttggcgaataggccgcagaaagaacttttcccactactcatattacttca |
23142120 |
T |
|
| Q |
220 |
agtata |
225 |
Q |
| |
|
|||||| |
|
|
| T |
23142119 |
agtata |
23142114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University