View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1834_low_27 (Length: 217)
Name: NF1834_low_27
Description: NF1834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1834_low_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 15 - 203
Target Start/End: Original strand, 41653860 - 41654048
Alignment:
| Q |
15 |
cctgtgacccttgtgagaatttaatattgttgatgttaagttttaggtgtattctaaaatgcatatagaacaattttcaggttttaaattagttacagca |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41653860 |
cctgtgacccttgtgagaatttaatattgttgatgttaagttttaggtgtattctaaaatgcatatagaacaattttcaggttttaaattagttacagct |
41653959 |
T |
 |
| Q |
115 |
agaaagattttgcacctttggctacaaccattt-agaacaacatctttgtagttgtatctaattaaatctttgtacggttatgattgatt |
203 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |||||||||||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
41653960 |
agaaagattttgcacc-ttggctacaaccatttaagaacaacatctttgtagttatatctaattaaatctttgtatggttatgattgatt |
41654048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University